Prev. |  KEGG KO K12757 > 

RIKEN DNA Bank Human Resource - MYL12A

Gene ID NCBI Gene 10627 |  KEGG hsa:10627
Gene Symbol MYL12A
Protein Name myosin light chain 12A
Synonyms HEL-S-24|MLC-2B|MLCB|MRCL3|MRLC3|MYL2B
Ortholog resources KEGG ortholog (KEGG orthology K12757) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03148 MRLC3/pBluescript Plasmid clone of human myosin regulatory light chain 3 cDNA
RDB03167 MRLC3/pGEX Plasmid clone of human myosin regulatory light chain 3 cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027936 IRAK069N24 pCMV-SPORT6 BC032748 NM_006471 Full
HGY029020 IRAK072J04 pBluescriptR BC031972 NM_006471
HGY095233 IRAL038B09 pDNR-LIB BC016372 NM_006471 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096843 M01C042B19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE096891 M01C042D19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE096939 M01C042F19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE096987 M01C042H19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE097035 M01C042J19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE097083 M01C042L19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE097131 M01C042N19 pDONR221 MGC10-G10 BC016372 ENST00000217652  
HGE097179 M01C042P19 pDONR221 MGC10-G10 BC016372 ENST00000217652  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042806 ARe07A06 pKA1U5 NM_006471.2  
GGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGNTTCTGGTGTTTGGCGTCGGAATT
HKR047305 ARe18E09 pKA1U5 NM_006471.2  
GAGACCCACTCTGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAG
HKR048149 ARe20G05 pKA1U5 NM_006471.2  
GAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGG
HKR050179 ARe25H11 pKA1U5 NM_006471.2  
ATCCTGGGCGCAGGGCGGCCCCGGTTCTGGTGTTTGGCGTCGGAATTAAACAACCACCAT
HKR051323 ARe28F03 pKA1U5 NM_006471.2  
GACACAGCCTAACGCTCTTCGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGTTCTG
HKR051755 ARe29G11 pKA1U5 NM_006471.2  
GACAGCCTAACGCTCTTCGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGTTCTGGT
HKR053323 ARe33F03 pKA1U5 NM_006471.2  
TGGCACAGCCTAACGCTCTTCGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGTTCT
HKR053677 ARe34D05 pKA1U5 NM_006471.2  
GGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGA
HKR063726 ARe59F06 pKA1U5 NM_006471.2  
GGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCT
HKR064057 ARe60C09 pKA1U5 NM_006471.2  
TGAGTAGTGCCTATTTTAGACCTGCTTGGAAGAATATAACTCAATGCAGTGTCTTACTTT
HKR074105 ARe85E09 pKA1U5 NM_006471.2  
TGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGC
HKR079355 ARe98G11 pKA1U5 NM_006471.2  
GTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACT
HKR160426 ARi01B02 pGCAP10 NM_006471.2  
GGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTG
HKR165356 ARi13G12 pGCAP10 NM_006471.2  
GGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGAC
HKR165650 ARi14C02 pGCAP10 NM_006471.2  
AGGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGG
HKR167675 ARi19D03 pGCAP10 NM_006471.2  
GGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGG
HKR170804 ARi27A04 pGCAP10 NM_006471.2  
AGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTTAACCACCACC
HKR173253 ARi33C05 pGCAP10 NM_006471.2  
GGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGG
HKR179281 ARi48D09 pGCAP10 NM_006471.2  
GAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGG
HKR180035 ARi50B11 pGCAP10 NM_006471.2  
GGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTT
HKR180932 ARi52F12 pGCAP10 NM_006471.2  
GAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGG
HKR182051 ARi55C03 pGCAP10 NM_006471.2  
GAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGG
HKR185258 ARi63C10 pGCAP10 NM_006471.2  
GAAGCANAGGCCGGAAGCGGTGGTTTTTANCGGCTCTCTGGGTAGCACGGTGGNGTGATA
HKR203234 ARiS008B10 pGCAP10 NM_006471.2  
GGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGG
HKR208011 ARiS020A11 pGCAP10 NM_006471.2  
GAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGC
HKR235349 ARiS088G05 pGCAP10 NM_006471.2  
TGAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTG
HKR238739 ARiS096O03 pGCAP10 NM_006471.2  
GAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGG
HKR243712 ARiS109E16 pGCAP10 NM_006471.2  
GGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGG
HKR276401 ARiS191A01 pGCAP10 NM_006471.2  
TGTGGAGTAGTGCCTATTTTAGACCTGCTTGGAAGAATATAACTCAATGCAGTGTCTTAC
HKR276441 ARiS191B17 pGCAP10 NM_006471.2  
GGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAG
HKR277782 ARiS194H14 pGCAP10 NM_006471.2  
GGTGATNGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGAC
HKR335379 RBb38H11 pGCAP1 NM_006471.2  
AAATGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGC
HKR346173 RBb65H05 pGCAP1 NM_006471.2  
GTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGAT
HKR360508 RBd01E12 pGCAP10 NM_006471.2  
GGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGG
HKR369205 RBd23A05 pGCAP10 NM_006471.2  
GCAGCCCNNCGNGGGTAGCAGGGTGGTGGGAGCCCGGGACCGAGGGGCTCGGANATGTGC
HKR369229 RBd23B05 pGCAP10 NM_006471.2  
GAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGC
HKR442117 RBdS105E21 pGCAP10 NM_006471.2  
GGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGA
HKR462698 RBdS156M10 pGCAP10 NM_006471.2  
GGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl