Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156M10

Clone ID RBdS156M10
HP ID HP00051
Gene ID 10627
Gene Symbol MYL12A
Protein Name myosin, light chain 12A, regulatory, non-sarcomeric
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006471.2
Length of RefSeq (bp) 1243
Chromosome 18p11.31
Reference DDBJ accession
UniGene Hs.190086
5'-terminal sequence GGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGA
2011.08.28