Prev. |  KEGG KO K09494 > 

RIKEN DNA Bank Human Resource - CCT2

Gene ID NCBI Gene 10576 |  KEGG hsa:10576
Gene Symbol CCT2
Protein Name chaperonin containing TCP1 subunit 2
Synonyms 99D8.1|CCT-beta|CCTB|HEL-S-100n|PRO1633|TCP-1-beta
Ortholog resource in our bank

  CCT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15073 pEF-BOS-FLAG-CCT beta Expression vector of chaperonin-containing TCP-1, subunit 2, human CCTbeta.
RDB15074 pEF-BOS-FLAG -T400P Expression vector of Leber congenital amaurosis (LCA) mutants of human CCTbeta, T400P.
RDB15075 pEF-BOS-FLAG-R516H Expression vector of Leber congenital amaurosis (LCA) mutants of human CCTbeta, R516H.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052476 ARe31D04 pKA1U5 NM_006431.2  
GAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG
HKR074122 ARe85F02 pKA1U5 NM_006431.2  
GGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACT
HKR160952 ARi02G08 pGCAP10 NM_006431.2  
GAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG
HKR162033 ARi05B09 pGCAP10 NM_006431.2  
TGGAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTC
HKR167206 ARi18A06 pGCAP10 NM_006431.2  
GAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG
HKR171697 ARi29E01 pGCAP10 NM_006431.2  
GTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACT
HKR276694 ARiS191M06 pGCAP10 NM_006431.2  
GACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGT
HKR324811 RBb12A11 pKA1U5 NM_006431.2  
GGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACT
HKR332927 RBb32F07 pGCAP1 NM_006431.2  
GGTGTGGCGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGG
HKR335249 RBb38C01 pGCAP1 NM_006431.2  
TGACGAGCTGGTGAGGGGATTCACTTTGTGTGCGGAACTCCTCGGAACCATGGCGTCCCT
HKR369653 RBd24C05 pGCAP10 NM_006431.2  
GGGGTGTGGTGNCCGCTCCCGCTCTCTGCTCTGCCCCCACCACGACCCCGCCCGGCCCCT
HKR396153 RBd90G09 pGCAP10 NM_006431.2  
GTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGGAACCATG
HKR420544 RBdS051F24 pGCAP10 NM_006431.2  
GAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG
HKR444211 RBdS110I19 pGCAP10 NM_006431.2  
GACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGT
HKR461690 RBdS154D18 pGCAP10 NM_006431.2  
GGCCCCGCCCCCCGAAGTAGGGCGTGTGGCGTCACTTCCGGCTTCCTTCAGTCCGCTGGT
HKR462492 RBdS156D20 pGCAP10 NM_006431.2  
GAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG
HKR471132 RBdS177N20 pGCAP10 NM_006431.2  
GAGTCCNCTGGTCCCNANNACNANCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl