Prev. |  Human A to Z list >  C >  CCT2 > 

RBb32F07 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR332927
Clone Name RBb32F07
Clone info. Plasmid clone of human CCT2 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GGTGTGGCGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGG
Sequence, submitted(2) AB593099 [link]
 
Sequence, refered NM_006431.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CCT2 (NCBI Gene 10576)  other clone of CCT2 in our bank
Synonyms 99D8.1|CCT-beta|CCTB|HEL-S-100n|PRO1633|TCP-1-beta
Protein Name chaperonin containing TCP1 subunit 2
KEGG hsa:10576
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR332927 RBb32F07 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2018.05.24

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl