Prev. |  KEGG KO K09499 > 

RIKEN DNA Bank Human Resource - CCT7

Gene ID NCBI Gene 10574 |  KEGG hsa:10574
Gene Symbol CCT7
Protein Name chaperonin containing TCP1 subunit 7
Synonyms CCTETA|CCTH|NIP7-1|TCP1ETA
Ortholog resources KEGG ortholog (KEGG orthology K09499) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083812 IRAL009I20 pOTB7 BC019296 NM_006429 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183611 ARi59A11 pGCAP10 NM_006429.2  
GGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGCGGGCCGCTGAATAAGCTTCCA
HKR186132 ARi65F12 pGCAP10 NM_006429.2  
GGNCGGCCCGGTCTCGGAGANAGGGGAGAGTGNGGCNNTGATANCTCAANGATGCCNCAC
HKR208062 ARiS020C14 pGCAP10 NM_006429.2  
GGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGCCCA
HKR219663 ARiS049C15 pGCAP10 NM_006429.2  
GGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAA
HKR243919 ARiS109N07 pGCAP10 NM_006429.2  
GGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGCGGGCCGCTGAATAAGCTTCCAAAA
HKR325276 RBb13D04 pKA1U5 NM_006429.2  
GGGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGNCAGTGGAGGGCCGCNTGAATAAGCTTC
HKR328102 RBb20E06 pKA1U5 NM_006429.2  
GGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAA
HKR341345 RBb53G01 pGCAP1 NM_006429.2  
GTGGATTGTGGGTTGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCT
HKR362927 RBd07F07 pGCAP10 NM_006429.2  
GATTTCTATTGCGCGAGGCATTGTGGGTTGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGA
HKR366836 RBd17B12 pGCAP10 NM_006429.2  
GGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGAT
HKR372149 RBd30G05 pGCAP10 NM_006429.2  
TGGCATTGTGGGTTGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCT
HKR372975 RBd32H07 pGCAP10 NM_006429.2  
GGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCA
HKR374129 RBd35F09 pGCAP10 NM_006429.2  
GCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGCC
HKR377650 RBd44C02 pGCAP10 NM_006429.2  
GGCTGGGCGGCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCA
HKR391729 RBd79F09 pGCAP10 NM_006429.2  
GTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGCCCACACC
HKR397254 RBd93C06 pGCAP10 NM_006429.2  
GCCCGGTCTCGGAGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGC
HKR416219 RBdS040J03 pGCAP10 NM_006429.2  
GGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGCCCACACCAGTTA
HKR474815 RBdS187A15 pGCAP10 NM_006429.2  
TGGATTTCTATTGCGCGAGGCATTGTGGGTTGCTGGGCGGCCCGGTCTCGGAGAAGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl