Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040J03

Clone ID RBdS040J03
HP ID HP02079
Gene ID 10574
Gene Symbol CCT7
Protein Name chaperonin containing TCP1, subunit 7 (eta)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006429.2
Length of RefSeq (bp) 1892
Chromosome 2p13.2
Reference DDBJ accession
UniGene Hs.368149
5'-terminal sequence GGAAGAGGGGAGAGTGGAGGGCCGCTGAATAAGCTTCCAAAATGATGCCCACACCAGTTA
2011.08.28