Prev. |  KEGG KO K13509 > 

RIKEN DNA Bank Human Resource - AGPAT2

Gene ID NCBI Gene 10555 |  KEGG hsa:10555
Gene Symbol AGPAT2
Protein Name 1-acylglycerol-3-phosphate O-acyltransferase 2
Synonyms 1-AGPAT2|BSCL|BSCL1|LPAAB|LPAAT-beta
Ortholog resource in our bank

  AGPAT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082212 IRAL005I20 pOTB7 BC004529 NM_001012727 Full
HGY083098 IRAL007M10 pOTB7 BC000026 NM_006412 Full/var
HGY083850 IRAL009K10 pOTB7 BC019292 NM_006412 Full/var
HGY088998 IRAL022I06 pOTB7 BC007269 NM_006412 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040909 W01A102E13 pENTR-TOPO IRAL007M10 BC000026 NM_006412  
HGE040911 W01A102E15 pENTR-TOPO IRAL007M10 BC000026 NM_006412  
HGE040915 W01A102E19 pENTR-TOPO IRAL007M10 BC000026 NM_006412  
HGE040917 W01A102E21 pENTR-TOPO IRAL007M10 BC000026 NM_006412  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178170 ARi45H02 pGCAP10 NM_001012727.1  
GGCCCTCGCAATAAGGGGCCTGAGCGCGCGGGGGAGAAGCGGGAGCGGGAGCGGGAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl