Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AGPAT2

Gene ID (NCBI) 10555
Gene Symbol AGPAT2
Protein Name 1-acylglycerol-3-phosphate O-acyltransferase 2
Synonyms 1-AGPAT2|BSCL|BSCL1|LPAAB|LPAAT-beta
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082212 IRAL005I20 pOTB7 BC004529 NM_001012727 Full
HGY083098 IRAL007M10 pOTB7 BC000026 NM_006412 Full/var
HGY083850 IRAL009K10 pOTB7 BC019292 NM_006412 Full/var
HGY088998 IRAL022I06 pOTB7 BC007269 NM_006412 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE040909 W01A102E13 pENTR-TOPO IRAL007M10 BC000026 NM_006412
HGE040911 W01A102E15 pENTR-TOPO IRAL007M10 BC000026 NM_006412
HGE040915 W01A102E19 pENTR-TOPO IRAL007M10 BC000026 NM_006412
HGE040917 W01A102E21 pENTR-TOPO IRAL007M10 BC000026 NM_006412

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR178170 ARi45H02 pGCAP10 NM_001012727.1
GGCCCTCGCAATAAGGGGCCTGAGCGCGCGGGGGAGAAGCGGGAGCGGGAGCGGGAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl