Prev. |  KEGG KO K18647 > 

RIKEN DNA Bank Human Resource - ANP32B

Gene ID NCBI Gene 10541 |  KEGG hsa:10541
Gene Symbol ANP32B
Protein Name acidic nuclear phosphoprotein 32 family member B
Synonyms APRIL|PHAPI2|SSP29
Ortholog resource in our bank

  ANP32B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011681 IRAK029D09 pCMV-SPORT6 BC019658 NM_006401 Full
HGY084162 IRAL010G18 pOTB7 BC013003 NM_006401 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042528 ARe06F08 pKA1U5 NM_006401.2  
GCTTTTCCCTCCATGGNTTTCTCTCCGCATCCCGCCCANTTAACATTGGCTCCGGGGGCA
HKR388950 RBd72G06 pGCAP10 NM_006401.2  
TGGCGCGGGGCCGAGTGGAGCCGAGCAGCTGCCGCGCCGCGTCGCCGGTTTAAGCGCAGT
HKR420603 RBdS051I11 pGCAP10 NM_006401.2  
GCTCCGCTCCCGTGAGTAACTTGGCTCCGGGGGCTCCGCTCGCCTGCCCGCACGCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl