Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051I11

Clone ID RBdS051I11
HP ID HP01771
Gene ID 10541
Gene Symbol ANP32B
Protein Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006401.2
Length of RefSeq (bp) 1617
Chromosome 9q22.32
Reference DDBJ accession
UniGene Hs.715547
5'-terminal sequence GCTCCGCTCCCGTGAGTAACTTGGCTCCGGGGGCTCCGCTCGCCTGCCCGCACGCCGCCC
2011.08.28