Prev. |  KEGG KO K08838 > 

RIKEN DNA Bank Human Resource - STK25

Gene ID NCBI Gene 10494 |  KEGG hsa:10494
Gene Symbol STK25
Protein Name serine/threonine kinase 25
Synonyms SOK1|YSK1
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  STK25

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088242 IRAL020K02 pOTB7 BC007852 NM_006374
HGY093855 IRAL034K15 pOTB7 BC015793 NM_006374 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046934 W01A117F14 pENTR-TOPO IRAL020K02 BC007852 NM_006374  
HGE046936 W01A117F16 pENTR-TOPO IRAL020K02 BC007852 NM_006374  
HGE046938 W01A117F18 pENTR-TOPO IRAL020K02 BC007852 NM_006374  
HGE046940 W01A117F20 pENTR-TOPO IRAL020K02 BC007852 NM_006374  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361249 RBd03C01 pGCAP10 NM_006374.3  
GACCGTTGCTTCGCGGGCTGGGAGGCCCGGGGTCCCCGGGCGAACAGAGGCTGCGGGTGG
HKR452988 RBdS132H20 pGCAP10 NM_006374.3  
GCCTCCGGTCGCTGCCGCCACCACCGTTGCTTCGCGGGCTGGGAGGCCCGGGGTCCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl