Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132H20

Clone ID RBdS132H20
HP ID HP05708
Gene ID 10494
Gene Symbol STK25
Protein Name serine/threonine kinase 25 (STE20 homolog, yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006374.3
Length of RefSeq (bp) 2198
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.516807
5'-terminal sequence GCCTCCGGTCGCTGCCGCCACCACCGTTGCTTCGCGGGCTGGGAGGCCCGGGGTCCCCGG
2011.08.28