DNA Bank Top |  KEGG KO K12755 > 

RIKEN DNA Bank Human Resource - MYL9

Gene ID NCBI Gene 10398 |  KEGG hsa:10398
Gene Symbol MYL9
Protein Name myosin light chain 9
Synonyms LC20|MLC-2C|MLC2|MMIHS4|MRLC1|MYRL2

Link

Ortholog resource in our bank

  MYL9


External database

human MYL9

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03166 MRLC1/pGEX Plasmid clone of human myosin regulatory light chain 1 cDNA    
RDB03146 MRLC1/pBluescript Plasmid clone of human myosin regulatory light chain 1 cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084907 IRAL012E11 pOTB7 BC002648 NM_181526 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084878 M01C012D06 pDONR221 FLJ03-H03 AK130879 NM_006097  
HGE084926 M01C012F06 pDONR221 FLJ03-H03 AK130879 NM_006097  
HGE084974 M01C012H06 pDONR221 FLJ03-H03 AK130879 NM_006097 done
HGE085022 M01C012J06 pDONR221 FLJ03-H03 AK130879 NM_006097  
HGE085070 M01C012L06 pDONR221 FLJ03-H03 AK130879 NM_006097  
HGE085118 M01C012N06 pDONR221 FLJ03-H03 AK130879 NM_006097  
HGE085166 M01C012P06 pDONR221 FLJ03-H03 AK130879 NM_006097  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042402 ARe06A02 pKA1U5 NM_006097.3  
GAGACCCGACGGCCGGCCCAGATTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCAC
HKR042503 ARe06E07 pKA1U5 NM_006097.3  
GAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGTAAGCCCCACCCAC
HKR048145 ARe20G01 pKA1U5 NM_006097.3  
TGGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCACCAGAAGCC
HKR049256 ARe23C08 pKA1U5 NM_006097.3  
GAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCACC
HKR049625 ARe24B01 pKA1U5 NM_006097.3  
ATCCTGGGGTCGGCTGAAGCGNCTTCTGCGCGGCNGCGGNAGCCCCATCCACNAGCAAGN
HKR054569 ARe36H01 pKA1U5 NM_006097.3  
ATCCTGAGTTCCACGCACCCAGCGAGCCCAAGCNCCTTTCTCCGCACCAGGGAAGCCCCA
HKR060976 ARe52H08 pKA1U5 NM_006097.3  
GACCCAGCGGAGCCCAAGACGCCTTCTCCGAGACCACGGTNAGNCCCACCCNCCAGAAGC
HKR065275 ARe63D03 pKA1U5 NM_006097.3  
ATCCTGAGTTCCACGCCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCA
HKR069653 ARe74C05 pKA1U5 NM_006097.3  
GACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGTAAGCCCCACCCACCAGAAGCCAA
HKR070551 ARe76G07 pKA1U5 NM_006097.3  
GAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGCANGCTCCACCCACCAGAAGCCAAGATG
HKR074451 ARe86C03 pKA1U5 NM_006097.3  
GAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACC
HKR074969 ARe87H01 pKA1U5 NM_006097.3  
GACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCACCAGAAGCCAAG
HKR078570 ARe96H02 pKA1U5 NM_006097.3  
GGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTC
HKR082004 ARf05A04 pKA1U5 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR168027 ARi20B03 pGCAP10 NM_006097.3  
GGCCCCGCCCCCGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGA
HKR172034 ARi30B10 pGCAP10 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR178054 ARi45C06 pGCAP10 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR182457 ARi56C09 pGCAP10 NM_006097.3  
GGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCACCAGAAGCCA
HKR184404 ARi61A04 pGCAP10 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR219904 ARiS049M16 pGCAP10 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR234058 ARiS085C10 pGCAP10 NM_006097.3  
GGCCTGGAGTCCAGACCCGACGGCCGGCCCAGTTCCACGCACCCAGCGAGCCCAAGCGCC
HKR234297 ARiS085M09 pGCAP10 NM_006097.3  
GCCAGTTCCACGCACCCAGCGAGCCCAAGCGCCTTCTCCGCACCAGGGAAGCCCCACCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl