Prev. | 

RIKEN DNA Bank Human Resource - APBB3

Gene ID NCBI Gene 10307 |  KEGG hsa:10307
Gene Symbol APBB3
Protein Name amyloid beta precursor protein binding family B member 3
Synonyms FE65L2|SRA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005430 IRAK013J14 pCMV-SPORT6 BC013158 NM_133174 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR383252 RBd58C04 pGCAP10 NM_133173.2  
GCCCGTGTCCCGCCCCGTATTTGTGCGGCGCCAGCTGGCCCCGCAGCCTGCGGCGCAGAG
HKR409024 RBdS022J08 pGCAP10 NM_133173.2  
GAGTAGCTCCAGAGGTCGCGCTGGGCTGAGAGTGCGGGCCGGCAGAGGCTGGCGGGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl