Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022J08

Clone ID RBdS022J08
HP ID HP08512
Gene ID 10307
Gene Symbol APBB3
Protein Name amyloid beta (A4) precursor protein-binding, family B, member 3?
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_133173.2
Length of RefSeq (bp) 2146
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.529449
5'-terminal sequence GAGTAGCTCCAGAGGTCGCGCTGGGCTGAGAGTGCGGGCCGGCAGAGGCTGGCGGGGAGC
2011.08.28