Prev. | 

RIKEN DNA Bank Human Resource - CDK2AP2

Gene ID NCBI Gene 10263 |  KEGG hsa:10263
Gene Symbol CDK2AP2
Protein Name cyclin dependent kinase 2 associated protein 2
Synonyms DOC-1R|p14
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085134 IRAL012N22 pOTB7 BC002850 NM_005851
HGY093084 IRAL032L20 pDNR-LIB BC016704 NM_005851 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208120 ARiS020E24 pGCAP10 NM_005851.3  
GAATCAGAGCGCGGCTGAGCGGCCCCGCAGCCAACCCCCGAGGAGCGGCCGGCTGGCGTC
HKR343747 RBb59G03 pGCAP1 NM_005851.3  
TGTGGGGGTGGGGCGCAGGGCTCGGGACGTCAAAGCCCTGCGTCCTTCGGCCCCCAGAGC
HKR366425 RBd16B01 pGCAP10 NM_005851.3  
GGCAGCCAACCCCCGAGGAGCGGCCGGCTGGCGTCCGCCGCGCCCAGGAGTTGGGGATGT
HKR408836 RBdS022B12 pGCAP10 NM_005851.3  
GACGGGGTGGGGCGCAGGGCTCGGGACGTCAAAGCCCTGCGTCCTTCGGCCCCCAGAGCG
HKR408864 RBdS022C16 pGCAP10 NM_005851.3  
GAGAGCGCGGCTGAGCGGCCCCGCAGCCAACCCCCGAGGAGCGGCCGGCTGGCGTCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl