Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022B12

Clone ID RBdS022B12
HP ID HP03893
Gene ID 10263
Gene Symbol CDK2AP2
Protein Name CDK2-associated protein 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005851.3
Length of RefSeq (bp) 1397
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.714816
5'-terminal sequence GACGGGGTGGGGCGCAGGGCTCGGGACGTCAAAGCCCTGCGTCCTTCGGCCCCCAGAGCG
2011.08.28