Prev. |  KEGG KO K13161 > 

RIKEN DNA Bank Human Resource - HNRNPR

Gene ID NCBI Gene 10236 |  KEGG hsa:10236
Gene Symbol HNRNPR
Protein Name heterogeneous nuclear ribonucleoprotein R
Synonyms HNRPR|hnRNP-R
Ortholog resources KEGG ortholog (KEGG orthology K13161) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081733 IRAL004F13 pOTB7 BC001449 NM_005826 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003089 W01A007M01 pENTR-TOPO IRAL004F13 BC001449 NM_005826 done
HGE003091 W01A007M03 pENTR-TOPO IRAL004F13 BC001449 NM_005826  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056150 ARe40G06 pKA1U5 NM_005826.3  
GCCATTTCTAGTCGTTTTCAAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCCGGCC
HKR060170 ARe50H02 pKA1U5 NM_005826.3  
ATCCTGGATTTCTAGTCGTTTTCAAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCC
HKR165353 ARi13G09 pGCAP10 NM_005826.3  
AAGCAGTTCCGGGAAACCCCGCGTGCTGCCGGGATCGCGTCTCAGTCCATCAGGGGGGGG
HKR322428 RBb06B04 pKA1U5 NM_005826.3  
GGCCATTTCTAGTCGTTTTCAAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCCGGC
HKR330829 RBb27B05 pGCAP1 NM_005826.3  
GGTCGTTTTCAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCCGGCCCCCGCTCTGC
HKR340005 RBb50A05 pGCAP1 NM_005826.3  
GTTTATTTCNAGGTCGATTTTCAAAGCGCCTCGCGCTTGATTCTCACGGTGCCCGGCTGC
HKR397770 RBd94H02 pGCAP10 NM_005826.3  
GATTTTCTAGTCGTTTTCAAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCCGGCCC
HKR398050 RBd95C02 pGCAP10 NM_005826.3  
GATTTTCTAGTCGTTTTCAAAGCGCCTCGCGCTGATTCTCACGGGCCCGGCTGCCGGCCC
HKR461767 RBdS154G23 pGCAP10 NM_005826.3  
GGGGCCCGGCTGCCGGCCCCCGCTCTGCCCTGCAGCATAATAAAATGGCTAATCAGGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl