Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154G23

Clone ID RBdS154G23
HP ID HP02484
Gene ID 10236
Gene Symbol HNRPR
Protein Name heterogeneous nuclear ribonucleoprotein R
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005826.3
Length of RefSeq (bp) 2751
Chromosome 1p36.12
Reference DDBJ accession
UniGene Hs.373763
5'-terminal sequence GGGGCCCGGCTGCCGGCCCCCGCTCTGCCCTGCAGCATAATAAAATGGCTAATCAGGTGA
2011.08.28