Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EIF1

Gene ID (NCBI) 10209
Gene Symbol EIF1
Protein Name eukaryotic translation initiation factor 1
Synonyms A121|EIF-1|EIF1A|ISO1|SUI1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083806 IRAL009I14 pOTB7 BC005118 NM_005801 Full
HGY089126 IRAL022N14 pOTB7 BC008710 NM_005801 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041308 ARe03E12 pKA1U5 NM_005801.3
GAGTCACTGAGCCGCCGCCGTAGGTATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCC
HKR041322 ARe03F02 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCANCNTTCCCCCTTGAGCCCCCTCGCT
HKR048011 ARe20A11 pKA1U5 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR048548 ARe21G04 pKA1U5 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR051682 ARe29D10 pKA1U5 NM_005801.3
GGCCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGC
HKR171206 ARi28A06 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR052810 ARe32A10 pKA1U5 NM_005801.3
GAGTTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCC
HKR056874 ARe42D02 pKA1U5 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR059201 ARe48A01 pKA1U5 NM_005801.3
GGATNTCCTGCTGGCCCAGATCACTGTAGACCGCCGGCGAGNCNTTTNGACAGCCTCCCC
HKR059300 ARe48E04 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR179256 ARi48C08 pGCAP10 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR179651 ARi49C03 pGCAP10 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR179723 ARi49F03 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR060075 ARe50D03 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTTCCCCCTTGAGCCCCCTCGCT
HKR060569 ARe51H01 pKA1U5 NM_005801.3
GCCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCNTCCCCCTTGAGCCCCCTCGCT
HKR182970 ARi57H02 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR187204 ARi68A04 pGCAP10 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTT
HKR187259 ARi68C11 pGCAP10 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR068172 ARe70H04 pKA1U5 NM_005801.3
TGGCCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCG
HKR068972 ARe72H04 pKA1U5 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR069254 ARe73C06 pKA1U5 NM_005801.3
GGCCCCAGGTCACTGCAGCCGCCGCCGAGGGATTCANCAGTCATCCCCCTTGGAGCCCCC
HKR071772 ARe79H04 pKA1U5 NM_005801.3
GCCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR188426 ARi71B02 pGCAP10 NM_005801.3
GCCCCGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTNCNGCCCTAGCTTCC
HKR074032 ARe85B08 pKA1U5 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR076405 ARe91A05 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR076825 ARe92B01 pKA1U5 NM_005801.3
GGCCCCAGATCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGC
HKR078053 ARe95C05 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR078977 ARe97H09 pKA1U5 NM_005801.3
GCCCAGNTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR208174 ARiS020H06 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR208298 ARiS020M10 pGCAP10 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR234910 ARiS087E14 pGCAP10 NM_005801.3
GAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTNGNTTCNNN
HKR243841 ARiS109K01 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCNNNCNN
HKR248906 ARiS122E10 pGCAP10 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCNTNGNT
HKR322908 RBb07E12 pKA1U5 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR323323 RBb08F03 pKA1U5 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR360881 RBd02D09 pGCAP10 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR329250 RBb23C02 pGCAP1 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR336478 RBb41D06 pGCAP1 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGTAGGATTCAGCAGCCTCCCCCNTTGAGCCCCCTCG
HKR379649 RBd49C01 pGCAP10 NM_005801.3
GGCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR342921 RBb57F01 pGCAP1 NM_005801.3
TGAGGTCACTGTAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCCTTGTAGCCCCCTTCGC
HKR382905 RBd57E09 pGCAP10 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTNNGCCCCCTCGCTTC
HKR344026 RBb60B02 pGCAP1 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR346035 RBb65B11 pGCAP1 NM_005801.3
GCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTC
HKR393355 RBd83G11 pGCAP10 NM_005801.3
TGAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCC
HKR395373 RBd88H05 pGCAP10 NM_005801.3
GCCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCT
HKR408975 RBdS022H07 pGCAP10 NM_005801.3
GCCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTT
HKR420629 RBdS051J13 pGCAP10 NM_005801.3
GAGAGGGCGGGAGGCCCGGGCGTTCCCCGAGCCTGGGGAAGCTGGCCGTCCCGGACTGAC
HKR452999 RBdS132I07 pGCAP10 NM_005801.3
CGGCCGGCCGATGCCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl