Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051J13

Clone ID RBdS051J13
HP ID HP00769
Gene ID 10209
Gene Symbol EIF1
Protein Name eukaryotic translation initiation factor 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005801.3
Length of RefSeq (bp) 1326
Chromosome 17q21.2
Reference DDBJ accession
UniGene Hs.150580
5'-terminal sequence GAGAGGGCGGGAGGCCCGGGCGTTCCCCGAGCCTGGGGAAGCTGGCCGTCCCGGACTGAC
2011.08.28