Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ALG3

Gene ID (NCBI) 10195
Gene Symbol ALG3
Protein Name ALG3, alpha-1,3- mannosyltransferase
Synonyms CDG1D|CDGS4|D16Ertd36e|NOT56L|Not56
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085076 IRAL012L12 pOTB7 BC002839 NM_005787 Full
HGY085450 IRAL013K10 pOTB7 BC004313 NM_005787 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE007150 W01A017O14 pENTR-TOPO IRAL012L12 BC002839 NM_005787
HGE007152 W01A017O16 pENTR-TOPO IRAL012L12 BC002839 NM_005787

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR165603 ARi14A03 pGCAP10 NM_005787.4
GGGTGGGCCCACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCC
HKR051205 ARe28A05 pKA1U5 NM_005787.4
GGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTTCCGCGGCCCAGGCAGA
HKR384034 RBd60B10 pGCAP10 NM_005787.4
TGGGCCGGTCCGGTTCCGCGGCCCAGGCAGAGGGACTCTGCAAGCAATGGCTGCAGCGCG
HKR405255 RBdS013C07 pGCAP10 NM_005787.4
GCCACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGG
HKR405897 RBdS014M09 pGCAP10 NM_005787.4
GACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTT
HKR432556 RBdS081G12 pGCAP10 NM_005787.4
GACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl