Prev. |  KEGG KO K03845 > 

RIKEN DNA Bank Human Resource - ALG3

Gene ID NCBI Gene 10195 |  KEGG hsa:10195
Gene Symbol ALG3
Protein Name ALG3 alpha-1,3- mannosyltransferase
Synonyms CDG1D|CDGS4|CDGS6|D16Ertd36e|NOT56L|Not56|not
Ortholog resource in our bank

  ALG3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085076 IRAL012L12 pOTB7 BC002839 NM_005787 Full
HGY085450 IRAL013K10 pOTB7 BC004313 NM_005787 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007150 W01A017O14 pENTR-TOPO IRAL012L12 BC002839 NM_005787  
HGE007152 W01A017O16 pENTR-TOPO IRAL012L12 BC002839 NM_005787  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051205 ARe28A05 pKA1U5 NM_005787.4  
GGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTTCCGCGGCCCAGGCAGA
HKR165603 ARi14A03 pGCAP10 NM_005787.4  
GGGTGGGCCCACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCC
HKR384034 RBd60B10 pGCAP10 NM_005787.4  
TGGGCCGGTCCGGTTCCGCGGCCCAGGCAGAGGGACTCTGCAAGCAATGGCTGCAGCGCG
HKR405255 RBdS013C07 pGCAP10 NM_005787.4  
GCCACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGG
HKR405897 RBdS014M09 pGCAP10 NM_005787.4  
GACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTT
HKR432556 RBdS081G12 pGCAP10 NM_005787.4  
GACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl