Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081G12

Clone ID RBdS081G12
HP ID HP03946
Gene ID 10195
Gene Symbol ALG3
Protein Name asparagine-linked glycosylation 3 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005787.4
Length of RefSeq (bp) 1537
Chromosome 3q27.1
Reference DDBJ accession
UniGene Hs.478481
5'-terminal sequence GACACAAGCGGCGCACCGTTAAGATGGCGGCTGGGCTGCGGAAACGCGGCCGGTCCGGTT
2011.08.28