Prev. |  KEGG KO K17265 > 

RIKEN DNA Bank Human Resource - G3BP1

Gene ID NCBI Gene 10146 |  KEGG hsa:10146
Gene Symbol G3BP1
Protein Name G3BP stress granule assembly factor 1
Synonyms G3BP|HDH-VIII
Ortholog resources KEGG ortholog (KEGG orthology K17265) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086700 IRAL016M12 pDNR-LIB BC006997 NM_198395 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022326 W01A055N14 pENTR-TOPO IRAL016M12 BC006997 NM_198395  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046077 ARe15D05 pKA1U5 NM_005754.2  
GGCGGACGCAGTTGCGTGAGGGGTTTGTGCTATCCTCGGTGCTGTGGTGCAGAGCTAGTT
HKR052106 ARe30E10 pKA1U5 NM_005754.2  
GGGCAGTTATATAGACCGGCGGCGGAGCACGCGCTGTGTGCGGACGCAGTTGCGTGAGGG
HKR058452 ARe46C04 pKA1U5 NM_005754.2  
GGGGGCAGGTAGTAAGCCGCGGCCGCCGCCTGGGCCCCAGGGCGGTCTCTGGGGCCAGGG
HKR160530 ARi01F10 pGCAP10 NM_005754.2  
GGTGCGGACGCAGTTGCGTGAGGGGTTTGTGCTATCCTCGGTGCTGTGGTGCAGAGCTAG
HKR166924 ARi17F04 pGCAP10 NM_005754.2  
GGGCCGCGGAGCGGAACAAGGATCCCATCTTGCACGTGCTGCGGCAGTACCTGGATCCGG
HKR180473 ARi51D01 pGCAP10 NM_005754.2  
GGTGCGGACGCAGTTGCGTGAGGGGTTTGTACTATCCTCGGTGCTGTGGTGCAGAGCTAG
HKR219697 ARiS049E01 pGCAP10 NM_005754.2  
GGTGCGGACGCAGTTGCGTGAGGGGTTTGTACTATCCTCGGTGCTGTGGTGCAGAGCTAG
HKR462656 RBdS156K16 pGCAP10 NM_005754.2  
GGTGCGGACGCAGTTGCGTGAGGGGTTTGTACTATCCTCGGTGCTGTGGTGCAGAGCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl