Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K16

Clone ID RBdS156K16
HP ID HP04856
Gene ID 10146
Gene Symbol G3BP1
Protein Name GTPase activating protein (SH3 domain) binding protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005754.2
Length of RefSeq (bp) 2855
Chromosome 5q33.1
Reference DDBJ accession
UniGene Hs.587054
5'-terminal sequence GGTGCGGACGCAGTTGCGTGAGGGGTTTGTACTATCCTCGGTGCTGTGGTGCAGAGCTAG
2011.08.28