RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - AKAP9

Gene ID	NCBI Gene 10142 \| KEGG hsa:10142
Gene Symbol	AKAP9
Protein Name	A-kinase anchoring protein 9
Synonyms	AKAP-9\|AKAP350\|AKAP450\|CG-NAP\|HYPERION\|LQT11\|MU-RMS-40.16A\|PPP1R45\|PRKA9\|YOTIAO

Ortholog resource in our bank

  AKAP9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence		CDS status⁽²⁾
Catalog number	Clone name	Vector	Submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX035236	IRAK088B12	pCMV-SPORT6	BC040932	NM_147185	Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR406369	RBdS015P09	pGCAP10	NM_005751.4
HKR406369	GGTTTACGTGGAGACGAAGATGGCGGCGGCGGCGGCGGTGACGGCGCTTCCCGTGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl