Prev. |  Human A to Z list >  A >  AKAP9 > 

RBdS015P09 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR406369
Clone Name RBdS015P09
Clone info. Plasmid clone of human AKAP9 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGTTTACGTGGAGACGAAGATGGCGGCGGCGGCGGCGGTGACGGCGCTTCCCGTGCGGCT
Sequence, submitted(2) n.a.
Note Partial CDS corresponding 1-1214nt of NM_005751.4 (cds 226 to 11949nt) and 1-1214nt of NM_147185.2 (226 to 11925nt).
 
Sequence, refered NM_005751.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) AKAP9 (NCBI Gene 10142)  other clone of AKAP9 in our bank
Synonyms AKAP-9|AKAP350|AKAP450|CG-NAP|HYPERION|LQT11|MU-RMS-40.16A|PPP1R45|PRKA9|YOTIAO
Protein Name A-kinase anchoring protein 9
KEGG hsa:10142
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR406369 RBdS015P09 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBdS015P09a.seq RBdS015P09b.seq RBdS015P09c.seq   RBdS015P09.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl