RBdS015P09 NRCD Human cDNA Clone

Prev. | Human A to Z list > A > AKAP9 >

RBdS015P09 - NRCD Human cDNA Clone


Catalog Number	HKR406369
Clone Name	RBdS015P09
Clone info.	Plasmid clone of human AKAP9 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GGTTTACGTGGAGACGAAGATGGCGGCGGCGGCGGCGGTGACGGCGCTTCCCGTGCGGCT
Sequence, submitted⁽³⁾	n.a.
Note	Partial CDS corresponding 1-1214nt of NM_005751.4 (cds 226 to 11949nt) and 1-1214nt of NM_147185.2 (226 to 11925nt).
Sequence, refered	NM_005751.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	AKAP9 (NCBI Gene 10142) other clone of AKAP9 in our bank
Synonyms	AKAP-9\|AKAP350\|AKAP450\|CG-NAP\|HYPERION\|LQT11\|MU-RMS-40.16A\|PPP1R45\|PRKA9\|YOTIAO
Protein Name	A-kinase anchoring protein 9

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR406369	RBdS015P09	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS015P09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR406369).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
RBdS015P09a.seq	RBdS015P09b.seq	RBdS015P09c.seq		RBdS015P09.pdf