Prev. |  KEGG KO K17260 > 

RIKEN DNA Bank Human Resource - ACTR2

Gene ID NCBI Gene 10097 |  KEGG hsa:10097
Gene Symbol ACTR2
Protein Name ARP2 actin related protein 2 homolog
Synonyms ARP2
Ortholog resources KEGG ortholog (KEGG orthology K17260) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029745 IRAK074G01 pBluescriptR BC036253 NM_005722 Partial/var
HGY087781 IRAL019H13 pDNR-LIB BC014546 NM_005722 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172849 ARi32C01 pGCAP10 NM_005722.3  
GGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGCTGCAGCGGCTCTTCCCTGGGC
HKR366852 RBd17C04 pGCAP10 NM_005722.3  
GGAAGACGCAAGAGGAAGAAGAGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGC
HKR378551 RBd46G07 pGCAP10 NM_005722.3  
GAAGAGGAAGAAGAGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGCTGCAGCGG
HKR433281 RBdS083D09 pGCAP10 NM_005722.3  
GNNTTGGAAGGANGNNCCGGNNNNACNCNANAGGAAGAAGAGAAAACGGCCGGGCGGCGG
HKR452839 RBdS132B15 pGCAP10 NM_005722.3  
GGCGGCGGCTTCCGGTCGGGGGAAAAAAGTTGGGCCGAAGGAGGGGCCGGGAAGACGCAA
HKR453068 RBdS132L04 pGCAP10 NM_005722.3  
GGAAGAAGAGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGCTGCAGCGGCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl