Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132L04

Clone ID RBdS132L04
HP ID HP01894
Gene ID 10097
Gene Symbol ACTR2
Protein Name ARP2 actin-related protein 2 homolog (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005722.3
Length of RefSeq (bp) 3929
Chromosome 2p14
Reference DDBJ accession
UniGene Hs.643727
5'-terminal sequence GGAAGAAGAGAAAACGGCCGGGCGGCGGTGGCTGTAGGTTGTGCGGCTGCAGCGGCTCTT
2011.08.28