Prev. |  KEGG KO K02260 > 

RIKEN DNA Bank Human Resource - COX17

Gene ID NCBI Gene 10063 |  KEGG hsa:10063
Gene Symbol COX17
Protein Name COX17, cytochrome c oxidase copper chaperone
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K02260) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087983 IRAL019P23 pDNR-LIB BC010933 NM_005694 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203454 ARiS008K14 pGCAP10 NM_005694.1  
GGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTG
HKR343722 RBb59F02 pGCAP1 NM_005694.1  
GGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTG
HKR348060 RBb70C12 pGCAP1 NM_005694.1  
GGTCTCAGGAGAAGAAGCCGCTGAAGCCCTGCTGCGCTTGCCCGGAGACCAAGAAGGCGC
HKR348108 RBb70E12 pGCAP1 NM_005694.1  
GGTCTCAGGAGAAGAAGCCGCTGAAGCCCTGCTGCGCTTGCCCGGAGACCAAGAAGGCGC
HKR368455 RBd21C07 pGCAP10 NM_005694.1  
GAGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATT
HKR381300 RBd53E04 pGCAP10 NM_005694.1  
GGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTG
HKR385608 RBd64A08 pGCAP10 NM_005694.1  
GATAGCTGCTTTTGGCGCGAAAGATGCCGGGTCTGGTTGACTCAAACCCTGCCCCGCCTG
HKR395629 RBd89B05 pGCAP10 NM_005694.1  
GGCTGCTTTTGGCGCGAAAGATGCCGGGTCTGGTTGACTCAAACCCTGCCCCGCCTGAGT
HKR402820 RBdS007A20 pGCAP10 NM_005694.1  
GAGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATT
HKR405905 RBdS014M17 pGCAP10 NM_005694.1  
GAGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATT
HKR433233 RBdS083B09 pGCAP10 NM_005694.1  
GCCTTCCTGTACTTTTTAGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl