Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083B09

Clone ID RBdS083B09
HP ID HP01481
Gene ID 10063
Gene Symbol COX17
Protein Name COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005694.1
Length of RefSeq (bp) 423
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.534383
5'-terminal sequence GCCTTCCTGTACTTTTTAGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCC
2011.08.28