DNA Bank Top |  KEGG KO K24983 > 

RIKEN DNA Bank Human Resource - G3BP2

Gene ID NCBI Gene 9908 |  KEGG hsa:9908
Gene Symbol G3BP2
Protein Name G3BP stress granule assembly factor 2
Synonyms -

Link

Ortholog resource in our bank

  G3BP2


External database

human G3BP2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04490 SEREX clone BRC-Co-41 #1 SEREX clone BRC-Co-41 #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091167 IRAL027P07 pOTB7 BC011731 NM_203504 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025411 W01A063I19 pENTR-TOPO IRAL027P07 BC011731 NM_203504  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327626 RBb19B02 pKA1U5 NM_012297.4  
GGCGGGACGTCCGTGGTCCTTGTCGCACGTCGCAGCNCCTGGCGCCCGGGTAAGAGGTGG
HKR361727 RBd04F07 pGCAP10 NM_012297.4  
CGGCCGGCCGATGGGCGCCCGGGAAGAGGTGGTTGTGAGGCAGACGAACTCGCGGCTCTC
HKR396927 RBd92F07 pGCAP10 NM_012297.4  
GATTGGGGATGAGGTGGCGAAGTGGGGGGGGAGGCACGCAGCAGCTCCCGAAGGCGCGCT
HKR405344 RBdS013F24 pGCAP10 NM_012297.4  
GGCGGTGGCAAAGGGGGCGGGACGTCCGTGGTCCTTGTCGCACGTCGCAGCGCCTGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl