Prev. |  Human A to Z list >  G >  G3BP2 > 

RBdS013F24 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR405344
Clone Name RBdS013F24
Clone info. Plasmid clone of human G3BP2 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGCGGTGGCAAAGGGGGCGGGACGTCCGTGGTCCTTGTCGCACGTCGCAGCGCCTGGCGC
Sequence, submitted(2) n.a.
 
Sequence, refered NM_012297.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) G3BP2 (NCBI Gene 9908)  other clone of G3BP2 in our bank
Synonyms -
Protein Name G3BP stress granule assembly factor 2
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR405344 RBdS013F24 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.01

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl