Prev. | 

RIKEN DNA Bank Human Resource - PCLAF

Gene ID NCBI Gene 9768 |  KEGG hsa:9768
Gene Symbol PCLAF
Protein Name PCNA clamp associated factor
Synonyms KIAA0101|L5|NS5ATP9|OEATC|OEATC-1|OEATC1|PAF|PAF15|p15(PAF)|p15/PAF|p15PAF
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081542 IRAL003O06 pOTB7 BC005832 NM_014736 Full
HGY088618 IRAL021J02 pDNR-LIB BC007101 NM_014736 Full
HGY092801 IRAL032A01 pDNR-LIB BC016782 NM_014736 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162945 ARi07G01 pGCAP10 NM_014736.4  
GGTCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTC
HKR235304 ARiS088E08 pGCAP10 NM_014736.4  
GGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTTCTTG
HKR264782 ARiS161P22 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR325659 RBb14C11 pKA1U5 NM_014736.4  
GCCTTGCTCCAGNTGAAACACCCTCGGCTGGGAAGCTCAGTTCGTTCTCTCCTCTCCTCT
HKR326129 RBb15F09 pKA1U5 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR332456 RBb31C08 pGCAP1 NM_014736.4  
GCCTTGNTCCAGTGAAACACCCTCGGCTGGGAAGTTCAGTTCGTTCTCTCCTCTCCTCTC
HKR342573 RBb56H05 pGCAP1 NM_014736.4  
GCCTTGGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCT
HKR348901 RBb72E05 pGCAP1 NM_014736.4  
TTGGCACTTAAAAGATTCC
HKR362834 RBd07B10 pGCAP10 NM_014736.4  
GCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTTC
HKR365249 RBd13C01 pGCAP10 NM_014736.4  
GGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTTCTTG
HKR368479 RBd21D07 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR374932 RBd37F12 pGCAP10 NM_014736.4  
HKR374956 RBd37G12 pGCAP10 NM_014736.4  
GGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTTCTTG
HKR378410 RBd46A10 pGCAP10 NM_014736.4  
GCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTTC
HKR380545 RBd51G01 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR385610 RBd64A10 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR390881 RBd77D09 pGCAP10 NM_014736.4  
GAATATAAACTGTGGCGGGATAGTTTTCGGGTCCTTGTCCAGTGAAACACCCTCGGCTGG
HKR390905 RBd77E09 pGCAP10 NM_014736.4  
GAATNTNANCTGNGGCGGGATCNTTTTCGGCNCCTTGCCCCNCGAAACNCCCTCGNCNGG
HKR394151 RBd85G07 pGCAP10 NM_014736.4  
GGTCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTC
HKR405767 RBdS014G23 pGCAP10 NM_014736.4  
GGTCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTC
HKR428111 RBdS070E15 pGCAP10 NM_014736.4  
GGTCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTC
HKR430033 RBdS075B09 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
HKR432420 RBdS081A20 pGCAP10 NM_014736.4  
GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl