Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075B09

Clone ID RBdS075B09
HP ID HP05346
Gene ID 9768
Gene Symbol KIAA0101
Protein Name KIAA0101
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014736.4
Length of RefSeq (bp) 1508
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.81892
5'-terminal sequence GCCTTGTCCAGTGAAACACCCTCGGCTGGGAAGTCAGTTCGTTCTCTCCTCTCCTCTCTT
2011.08.28