Prev. |  KEGG KO K16458 > 

RIKEN DNA Bank Human Resource - CEP104

Gene ID NCBI Gene 9731 |  KEGG hsa:9731
Gene Symbol CEP104
Protein Name centrosomal protein 104
Synonyms CFAP256|GlyBP|JBTS25|KIAA0562|ROC22
Ortholog resources KEGG ortholog (KEGG orthology K16458) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036633 IRAK091J17 pBluescript BC047450 NM_014704 Partial/var
HGY080950 IRAL002G06 pOTB7 BC001640 NM_014704 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462726 RBdS156N14 pGCAP10 NM_014704.2  
GGTCATGAGAGTGGAGGCTGCGGCCGGGGCTATGGGCAGAGGCGGCCGGGTCTGCTTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl