Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156N14

Clone ID RBdS156N14
HP ID HP09248
Gene ID 9731
Gene Symbol KIAA0562
Protein Name KIAA0562
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014704.2
Length of RefSeq (bp) 3770
Chromosome 1p36.32
Reference DDBJ accession
UniGene Hs.509017
5'-terminal sequence GGTCATGAGAGTGGAGGCTGCGGCCGGGGCTATGGGCAGAGGCGGCCGGGTCTGCTTCTT
2011.08.28