RIKEN DNA Bank Human Resource

Prev. | KEGG KO K20101 >

RIKEN DNA Bank Human Resource - DHX34

Gene ID	NCBI Gene 9704 \| KEGG hsa:9704
Gene Symbol	DHX34
Protein Name	DExH-box helicase 34
Synonyms	DDX34\|HRH1

Ortholog resource in our bank

  DHX34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR376084	RBd40D12	pGCAP10	NM_014681.4
HKR376084	TGGAGGTCTGCGGGCGCTGGAAAATCCGGCCCGAGATGTAGAGCTGANAGTGCCTGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl