Prev. |  Human A to Z list >  D >  DHX34 > 

RBd40D12 - NRCD Human cDNA Clone

Catalog Number HKR376084
Clone Name RBd40D12
Clone info. Plasmid clone of human DHX34 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) TGGAGGTCTGCGGGCGCTGGAAAATCCGGCCCGAGATGTAGAGCTGANAGTGCCTGACGG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_014681.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) DHX34 (NCBI Gene 9704)  other clone of DHX34 in our bank
Synonyms DDX34|HRH1
Protein Name DExH-box helicase 34
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR376084 RBd40D12 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd40D12 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR376084).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl