Prev. |  KEGG KO K17943 > 

RIKEN DNA Bank Human Resource - PUM1

Gene ID NCBI Gene 9698 |  KEGG hsa:9698
Gene Symbol PUM1
Protein Name pumilio RNA binding family member 1
Synonyms HSPUM|PUMH|PUMH1|PUML1|SCA47
Ortholog resource in our bank

  PUM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084697 IRAL011M09 pOTB7 BC013398 NM_014676 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098008 M01C045A08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098056 M01C045C08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098104 M01C045E08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098152 M01C045G08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098200 M01C045I08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098248 M01C045K08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098296 M01C045M08 pDONR221 MGC12-B04 BC013398 NM_014676  
HGE098344 M01C045O08 pDONR221 MGC12-B04 BC013398 NM_014676  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR452830 RBdS132B06 pGCAP10 NM_001020658.1  
TTGAGTGGGCCGCCATGTTGTCGGAGTGAAAGGTAAGGGGGAGCGAGAGCGCCAGAGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl