Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132B06

Clone ID RBdS132B06
HP ID HP09180
Gene ID 9698
Gene Symbol PUM1
Protein Name pumilio homolog 1 (Drosophila)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001020658.1
Length of RefSeq (bp) 5416
Chromosome 1p35.2
Reference DDBJ accession
UniGene Hs.281707
5'-terminal sequence TTGAGTGGGCCGCCATGTTGTCGGAGTGAAAGGTAAGGGGGAGCGAGAGCGCCAGAGAGA
2011.08.28