Prev. |  KEGG KO K08328 > 

RIKEN DNA Bank Human Resource - GUCA1C

Gene ID NCBI Gene 9626 |  KEGG hsa:9626
Gene Symbol GUCA1C
Protein Name guanylate cyclase activator 1C
Synonyms GCAP3
Ortholog resource in our bank

  GUCA1C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428292 RBdS070M04 pGCAP10 NM_005459.3 VA done
CGGCCGGCCGATGAGACTGTGAGTCAAGATGGGGAATGGCAAATCTATAGCTGGTGATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl