Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GUCA1C

Gene ID (NCBI) 9626
Gene Symbol GUCA1C
Protein Name guanylate cyclase activator 1C
Synonyms GCAP3
Databases KEGG hsa:9626 |  NCBI Gene 9626
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08328)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR428292 RBdS070M04 pGCAP10 NM_005459.3  
CGGCCGGCCGATGAGACTGTGAGTCAAGATGGGGAATGGCAAATCTATAGCTGGTGATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl