RBdS070M04 NRCD Human cDNA Clone

Prev. | Human A to Z list > G > GUCA1C >

RBdS070M04 - NRCD Human cDNA Clone


Catalog Number	HKR428292
Clone Name	RBdS070M04
Clone info.	Plasmid clone of human GUCA1C cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	CGGCCGGCCGATGAGACTGTGAGTCAAGATGGGGAATGGCAAATCTATAGCTGGTGATCA
Sequence, submitted⁽³⁾	AB593147 [link]
Note	match to NM_005459.4 (118-747) CDS:full/var, nt331G>A,nt370A>G
Sequence, refered	NM_005459.3 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	GUCA1C (NCBI Gene 9626) other clone of GUCA1C in our bank
Synonyms	GCAP3
Protein Name	guanylate cyclase activator 1C

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR428292	RBdS070M04	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS070M04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR428292).

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
RBdS070M04a.seq		RBdS070M04c.seq	RBdS070M04z.seq	RBdS070M04.pdf