Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5J2

Gene ID (NCBI) 9551
Gene Symbol ATP5J2
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Synonyms ATP5JL
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02130)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086513 IRAL016E17 pDNR-LIB BC003678 NM_004889 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096408 M01C041A08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096456 M01C041C08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096504 M01C041E08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096552 M01C041G08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096600 M01C041I08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096648 M01C041K08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096696 M01C041M08 pDONR221 MGC10-B04 BC003678 NM_004889  
HGE096744 M01C041O08 pDONR221 MGC10-B04 BC003678 NM_004889  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166459 ARi16C11 pGCAP10 NM_004889.2  
GACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTT
HKR055356 ARe38G12 pKA1U5 NM_004889.2  
GGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAAC
HKR056402 ARe41A02 pKA1U5 NM_004889.2  
TGGGCACAGCCGGACACCAGGACTCCAAAATGGCGCTCAGTTGGTGAGTGTCCGGCCCCA
HKR177652 ARi44C04 pGCAP10 NM_004889.2  
GAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCT
HKR064953 ARe62G09 pKA1U5 NM_004889.2  
GAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCT
HKR066410 ARe66A10 pKA1U5 NM_004889.2  
TGACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGT
HKR068433 ARe71B09 pKA1U5 NM_004889.2  
GGGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAA
HKR247405 ARiS118I13 pGCAP10 NM_004889.2  
GAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAA
HKR264690 ARiS161M02 pGCAP10 NM_004889.2  
GACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCA
HKR277684 ARiS194D12 pGCAP10 NM_004889.2  
GACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTT
HKR320403 RBb01A03 pKA1U5 NM_004889.2  
GACACAGCGGACACCAGGTACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTT
HKR322080 RBb05D08 pKA1U5 NM_004889.2  
GGCAGCCCTCGCACGGTCCGGCACAGCGGACACCAGGTACTCCAAAATGGCGTCAGTTGT
HKR364151 RBd10G07 pGCAP10 NM_004889.2  
GACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTT
HKR369631 RBd24B07 pGCAP10 NM_004889.2  
GGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTA
HKR373659 RBd34C11 pGCAP10 NM_004889.2  
GACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAGTGAAGGAC
HKR382408 RBd56A08 pGCAP10 NM_004889.2  
GACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCANNGNNGGACAAGAAACTT
HKR345746 RBb64G02 pGCAP1 NM_004889.2  
TATGCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACA
HKR386056 RBd65C08 pGCAP10 NM_004889.2  
GCCGGCNCAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAG
HKR406249 RBdS015K09 pGCAP10 NM_004889.2  
TGAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAG
HKR461927 RBdS154N15 pGCAP10 NM_004889.2  
GGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl