Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154N15

Clone ID RBdS154N15
HP ID HP00955
Gene ID 9551
Gene Symbol ATP5J2
Protein Name ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004889.2
Length of RefSeq (bp) 512
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.521056
5'-terminal sequence GGCCCTCGCGCGGTCCGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCA
2011.08.28