Prev. |  KEGG KO K10258 > 

RIKEN DNA Bank Human Resource - TECR

Gene ID NCBI Gene 9524 |  KEGG hsa:9524
Gene Symbol TECR
Protein Name trans-2,3-enoyl-CoA reductase
Synonyms GPSN2|MRT14|SC2|TER
Ortholog resources KEGG ortholog (KEGG orthology K10258) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001227 IRAK003B03 pCMV-SPORT6 BC000174 NM_138501 Partial
HGY082351 IRAL005O15 pOTB7 BC002425 NM_138501 Full
HGY085922 IRAL014N10 pOTB7 BC013881 NM_138501 Full
HGY086644 IRAL016K04 pDNR-LIB BC005384 NM_138501 Full/var
HGY088159 IRAL020G15 pOTB7 BC007801 NM_138501 Full
HGY088458 IRAL021C10 pDNR-LIB BC005952 NM_138501 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049683 ARe24D11 pKA1U5 NM_138501.4  
GGGAGCCTGTGCTGTGCCGCGCAGTTAGGCAGCAGCAGCCGCGGAGCAGTAGCCGCCGTG
HKR182908 ARi57E12 pGCAP10 NM_138501.4  
CGGCCGGCCGATGATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCA
HKR320850 RBb02C02 pKA1U5 NM_138501.4  
GAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGC
HKR363728 RBd09F08 pGCAP10 NM_138501.4  
GAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGC
HKR365208 RBd13A08 pGCAP10 NM_138501.4  
GATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGCAGCAG
HKR374409 RBd36A09 pGCAP10 NM_138501.4  
GAGAGCCGCGTTTAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCC
HKR385684 RBd64D12 pGCAP10 NM_138501.4  
TGATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGCAGCA
HKR385708 RBd64E12 pGCAP10 NM_138501.4  
TGATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGCAGCA
HKR405734 RBdS014F14 pGCAP10 NM_138501.4  
GAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGC
HKR416010 RBdS040A10 pGCAP10 NM_138501.4  
GAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAGTTAGGC
HKR433202 RBdS083A02 pGCAP10 NM_138501.4  
GGCGTTTAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl