Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083A02

Clone ID RBdS083A02
HP ID HP00645
Gene ID 9524
Gene Symbol GPSN2
Protein Name glycoprotein, synaptic 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138501.4
Length of RefSeq (bp) 1197
Chromosome 19p13.12
Reference DDBJ accession
UniGene Hs.515642
5'-terminal sequence GGCGTTTAGTCTATCGCTGCGGTTGCGAGCGCTGTAGGGAGCCTGTGCTGTGCCGCGCAG
2011.08.28