Prev. |  KEGG KO K01074 > 

RIKEN DNA Bank Human Resource - PPT2

Gene ID NCBI Gene 9374 |  KEGG hsa:9374
Gene Symbol PPT2
Protein Name palmitoyl-protein thioesterase 2
Synonyms C6orf8|G14|PPT-2
Featured content Lysosome (human)
Ortholog resource in our bank

  PPT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081601 IRAL004A01 pOTB7 BC001355 NM_005155 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321626 RBb04B02 pKA1U5 NM_005155.5  
GGTCATTCCCCTGCGCTCTCTTTCCTCACCCTTCCCCCCGCCACCGNTGGGTTCCAGACT
HKR405806 RBdS014I14 pGCAP10 NM_005155.5  
GGCCTACGGACCCAGGCCAGGTGGGAGTCTGCACTCTTCAAGGGGCCTGGGCTGCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl