Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014I14

Clone ID RBdS014I14
HP ID HP05211
Gene ID 9374
Gene Symbol PPT2
Protein Name palmitoyl-protein thioesterase 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005155.5
Length of RefSeq (bp) 2202
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.635690
5'-terminal sequence GGCCTACGGACCCAGGCCAGGTGGGAGTCTGCACTCTTCAAGGGGCCTGGGCTGCTGCTC
2011.08.28