Prev. | 

RIKEN DNA Bank Human Resource - BCL7B

Gene ID NCBI Gene 9275 |  KEGG hsa:9275
Gene Symbol BCL7B
Protein Name BAF chromatin remodeling complex subunit BCL7B
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001580 IRAK003P20 pCMV-SPORT6 BC000956 NM_138707
HGX001636 IRAK004B12 pCMV-SPORT6 BC001967 NM_138707 Partial
HGX005823 IRAK014J07 pCMV-SPORT6 BC009548 NM_138707 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122404 ARh06A04 pGCAP1 NM_001707.2  
GGCGCGCACGGAGGGGGCGACGGCCGCTGTGA.CGCTGCGGCGGCGGCGG.GCG
HKR360903 RBd02E07 pGCAP10 NM_001707.2  
GGGCGGGCGGGCGGCGGCGCGTGAGGCGCGCGATCCCCGGTGTCTTGGGAGCAGTGCCCC
HKR385303 RBd63E07 pGCAP10 NM_001707.2  
CCAATGGAGGGGGCGACGGCCGCTGTGACGCTGCGGCGGCGGCGGGCGGGCGGCGGCGCG
HKR461675 RBdS154D03 pGCAP10 NM_001707.2  
GGCGCACGGAGGGGGCGACGGCCGCTGTGACGCTGCGGCGGCGGCGGGCGGGCGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl