Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154D03

Clone ID RBdS154D03
HP ID HP01278
Gene ID 9275
Gene Symbol BCL7B
Protein Name B-cell CLL/lymphoma 7B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001707.2
Length of RefSeq (bp) 1690
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.647051
5'-terminal sequence GGCGCACGGAGGGGGCGACGGCCGCTGTGACGCTGCGGCGGCGGCGGGCGGGCGGCGGCG
2011.08.28